RESUMO
The integration of low-dimensional nanomaterials with microscale architectures in flexible pressure sensors has garnered significant interest due to their outstanding performance in healthcare monitoring. However, achieving high sensitivity across different magnitudes of external pressure remains a critical challenge. Herein, we present a high-performance flexible pressure sensor crafted from biomimetic hibiscus flower microstructures coated with silver nanowires. When compared with a flat electrode, these microstructures as electrodes display significantly enhanced sensitivity and an extended stimulus-response range. Furthermore, we utilized an ionic gel film as the dielectric layer, resulting in an enhancement of the overall performance of the flexible pressure sensor through an increase in interfacial capacitance. Consequently, the capacitive pressure sensor exhibits an extraordinary ultrahigh sensitivity of 48.57 [Kpa]-1 within the pressure range of 0-1 Kpa, 15.24 [Kpa]-1 within the pressure range of 1-30 Kpa, and 3.74 [Kpa]-1 within the pressure range of 30-120 Kpa, accompanied by a rapid response time (<58 ms). The exceptional performance of our flexible pressure sensor serves as a foundation for its numerous applications in healthcare monitoring. Notably, the flexible pressure sensor excels not only in detecting subtle physiological signals such as finger and wrist pulse signals, vocal cord vibrations, and breathing intensity but also demonstrates excellent performance in monitoring higher pressures, such as plantar pressure. We foresee that this flexible pressure sensor possesses significant potential in the field of wearable electronics.
RESUMO
INTRODUCTION: Chimeric antigen receptor (CAR)-T cells obtained long-term durability in about 30% to 40% of relapsed/refractory (r/r) B-cell non-Hodgkin lymphoma (B-NHL). Maintenance therapy after CAR-T is necessary, and PD1 inhibitor is one of the important maintenance therapy options. METHODS: A total of 173 r/r B-NHL patients treated with PD1 inhibitor maintenance following CD19/22 CAR-T therapy alone or combined with autologous hematopoietic stem cell transplantation (ASCT) from March 2019 to July 2022 were assessed for eligibility for two trials. There were 81 patients on PD1 inhibitor maintenance therapy. RESULTS: In the CD19/22 CAR-T therapy trial, the PD1 inhibitor maintenance group indicated superior objective response rate (ORR) (82.9% vs 60%; P = 0.04) and 2-year progression-free survival (PFS) (59.8% vs 21.3%; P = 0.001) than the non-maintenance group. The estimated 2-year overall survival (OS) was comparable in the two groups (60.1% vs 45.1%; P = 0.112). No difference was observed in the peak expansion levels of CD19 CAR-T and CD22 CAR-T between the two groups. The persistence time of CD19 and CD22 CAR-T in the PD1 inhibitor maintenance group was longer than that in the non-maintenance group. In the CD19/22 CAR-T therapy combined with ASCT trial, no significant differences in ORR (81.4% vs 84.8%; P = 0.67), 2-year PFS (72.3% vs 74.9%; P = 0.73), and 2-year OS (84.1% vs 80.7%; P = 0.79) were observed between non-maintenance and PD1 inhibitor maintenance therapy groups. The peak expansion levels and duration of CD19 and CD22 CAR-T were not statistically different between the two groups. During maintenance treatment with PD1 inhibitor, all adverse events were manageable. In the multivariable analyses, type and R3m were independent predictive factors influencing the OS of r/r B-NHL with PD1 inhibitor maintenance after CAR-T therapy. CONCLUSION: PD1 inhibitor maintenance following CD19/22 CAR-T therapy obtained superior response and survival in r/r B-NHL, but not in the trial of CD19/22 CAR-T cell therapy combined with ASCT.
RESUMO
BACKGROUND: Breast cancer is the most common cancer in women, and in advanced stages, it often metastasizes to the brain. However, research on the biological mechanisms of breast cancer brain metastasis and potential therapeutic targets are limited. METHODS: Differential gene expression analysis (DEGs) for the datasets GSE43837 and GSE125989 from the GEO database was performed using online analysis tools such as GEO2R and Sangerbox. Further investigation related to SULF1 was conducted using online databases such as Kaplan-Meier Plotter and cBioPortal. Thus, expression levels, variations, associations with HER2, biological processes, and pathways involving SULF1 could be analyzed using UALCAN, cBioPortal, GEPIA2, and LinkedOmics databases. Moreover, the sensitivity of SULF1 to existing drugs was explored using drug databases such as RNAactDrug and CADSP. RESULTS: High expression of SULF1 was associated with poor prognosis in advanced breast cancer brain metastasis and was positively correlated with the expression of HER2. In the metastatic breast cancer population, SULF1 ranked top among the 16 DEGs with the highest mutation rate, reaching 11%, primarily due to amplification. KEGG and GSEA analyses revealed that the genes co-expressed with SULF1 were positively enriched in the 'ECM-receptor interaction' gene set and negatively enriched in the 'Ribosome' gene set. Currently, docetaxel and vinorelbine can act as treatment options if the expression of SULF1 is high. CONCLUSIONS: This study, through bioinformatics analysis, unveiled SULF1 as a potential target for treating breast cancer brain metastasis (BM).
RESUMO
Ultra-high-performance concrete (UHPC), a new cement-based material that offers high mechanical strength and good durability, has been widely applied in construction and rehabilitation projects in recent years. An optimum bending system is achieved by positioning the UHPC layer at the bottom tensile zone of the composite beam and placing the normal-strength concrete (NC) layer at the upper compression zone, which is described as the UHPC-NC composite beam. The fatigue behavior of reinforced UHPC-NC composite beams was described in this study, with an emphasis on the effects of UHPC layer thickness and fatigue load level on the fatigue life of the beam, deformation of the interface between UHPC and NC layers, as well as the bending stiffness of the beam. A total of 9 reinforced UHPC-NC composite beams were tested under cyclic loading. The test variables include UHPC layer thicknesses (zero, 200, and 360 mm), reinforcement ratios (1.184% and 1.786%), and the upper load levels (0.39~0.65). The results showed that good bonding had been achieved without delamination between UHPC and NC layers prior to the final fatigue failure of the beam, and the bending stiffness of the composite beam experienced a three-stage reduction under cyclic loading. Furthermore, an equation was proposed to predict the stiffness reduction coefficient of UHPC-NC composite beams under cyclic loading.
RESUMO
It is necessary to explore new targets for the treatment of colon adenocarcinoma (COAD) according to the tumor microenvironment. The expression levels of JAML and CXADR were analyzed by bioinformatics analysis and validation of clinical samples. JAML over-expression CD8+ T cell line was constructed, and the proliferation activity was detected by MTT. The production of inflammatory factors was detected by ELISA. The expression of immune checkpoint PD-1 and TIM-3 was detected by Western blot. The apoptosis level was detected by flow cytometry and apoptosis markers. The AOM/DSS mouse model of colorectal cancer was constructed. The expression levels of JAML, CXADR and PD-1 were detected by PCR and Western blot, and the proportion of CD8+ T cells and exhausted T cells were detected by flow cytometry. The expression levels of JAML and CXADR were significantly decreased in colon cancer tissues. Overexpression of JAML can promote the proliferation of T cells, secrete a variety of inflammatory factors. Overexpression of CXADR can reduce the proliferation of colorectal cancer cells, promote apoptosis, and down-regulate the migration and invasion ability of tumor cells. Both JAML agonists and PD-L1 inhibitors can effectively treat colorectal cancer, and the combined use of JAML agonists and PD-L1 inhibitors can enhance the effect. JAML can promote the proliferation and toxicity of CD8+ T cells and down-regulate the expression of immune checkpoints in colon cancer. CXADR can inhibit the proliferation of cancer cells and promote the apoptosis. JAML agonist can effectively treat colorectal cancer by regulating CD8+ T cells.
RESUMO
Tongue squamous cell carcinoma (TSCC) is a prevalent form of oral malignancy, with increasing incidence. Unfortunately, the 5-year survival rate for patients has not exceeded 50%. Studies have shown that sex-determining region Y box 9 (SOX9) correlates with malignancy and tumor stemness in a variety of tumors. To investigate the role of SOX9 in TSCC stemness, we analyzed its influence on various aspects of tumor biology, including cell proliferation, migration, invasion, sphere and clone formation, and drug resistance in TSCC. Our data suggest a close association between SOX9 expression and both the stemness phenotype and drug resistance in TSCC. Immunohistochemical experiments revealed a progressive increase of SOX9 expression in normal oral mucosa, paracancerous tissues, and tongue squamous carcinoma tissues. Furthermore, the expression of SOX9 was closely linked to the TNM stage, but not to lymph node metastasis or tumor diameter. SOX9 is a crucial gene in TSCC responsible for promoting the stemness function of cancer stem cells. Developing drugs that target SOX9 is extremely important in clinical settings.
Assuntos
Carcinoma de Células Escamosas , Neoplasias Bucais , Neoplasias da Língua , Humanos , Carcinoma de Células Escamosas/patologia , Neoplasias da Língua/metabolismo , Linhagem Celular Tumoral , Neoplasias Bucais/genética , Língua/metabolismo , Língua/patologia , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Movimento Celular/genética , Fatores de Transcrição SOX9/genética , Fatores de Transcrição SOX9/metabolismoRESUMO
The increasing depth of mine excavation presents greater challenges in mine ventilation and in managing cooling energy consumption. Therefore, there is an urgent need for comprehensive research on jet ventilation influenced by low-speed crossflows. This study investigated the impact of flow velocity ratios (R) and jet exit diameters (d) on flow-field distribution and flow characteristics through velocity measurements and smoke flow visualization experiments. The results of the study revealed two distinct types of air lakes formed by jet ventilation in crossflow (JVIC), with one being wall-attached and the other suspended. Notably, a significant secondary flow phenomenon was observed in the near-field near the upper wall. Additionally, the deflection angle (θj) of JVIC decreases as R and d/D increase, leading to the formation and movement of a semi-confined point (SP) and a confined point (CP) in the -x direction. Moreover, the wall confinement effect diminishes the jet's diffusion and deflection ability in the -z direction, leading to increased penetration in the x direction. Before the formation of the SP, the deflection section of the jet lengthens, followed by a rapid shortening upon its formation. Finally, the study further developed empirical equations for the jet axial trajectory and diffusion width.
RESUMO
Cutaneous wound healing is a challenge in plastic and reconstructive surgery. In theory, cells undergoing mesenchymal transition will achieve re-epithelialization through mesenchymal-epithelial transition at the end of wound healing. But in fact, some pathological stimuli will inhibit this biological process and result in scar formation. If mesenchymal-epithelial transition can be activated at the corresponding stage, the ideal wound healing may be accomplished. Two in vivo skin defect mouse models and dermal-derived mesenchymal cells were used to evaluate the effect of lithium chloride in wound healing. The mesenchymal-epithelial transition was detected by immunohistochemistry staining. In vivo, differentially expressed genes were analysed by transcriptome analyses and the subsequent testing was carried out. We found that lithium chloride could promote murine cutaneous wound healing and facilitate mesenchymal-epithelial transition in vivo and in vitro. In lithium chloride group, scar area was smaller and the collagen fibres are also orderly arranged. The genes related to mesenchyme were downregulated and epithelial mark genes were activated after intervention. Moreover, transcriptome analyses suggested that this effect might be related to the inhibition of CXCL9 and IGF2, subsequent assays demonstrated it. Lithium chloride can promote mesenchymal-epithelial transition via downregulating CXCL9 and IGF2 in murine cutaneous wound healing, the expression of IGF2 is regulated by ß-catenin. It may be a potential promising therapeutic drug for alleviating postoperative scar and promoting re-epithelialization in future.
Assuntos
Cicatriz , Cloreto de Lítio , Animais , Camundongos , Cloreto de Lítio/farmacologia , Diferenciação Celular , Cicatrização , PeleRESUMO
The harmless and high-value conversion of organic waste are the core problems to be solved by composting technology. This study introduced an innovative method of promoting targeted humification and nitrogen retention in composting by adding p-benzoquinone (PBQ), the composting without any additives was set as control group (CK). The results indicated that the addition of exogenous quinones led to a 30.1% increase in humic acid (HA) content during the heating and thermophilic phases of composting. Spectroscopic analyses confirmed that exogenous quinones form the core skeleton structure of amino-quinones in HA through composting biochemical reactions. This accelerated the transformation of quinones into recalcitrant HA in the early stages of composting, and reduced CO2 and NH3 by 8% and 78%, respectively. Redundancy analysis (RDA) revealed that the decrease in carbon and nitrogen losses primarily correlated with quinones enhancing HA formation and greater nitrogen incorporation into HA (P < 0.05). Furthermore, the compost treated with quinones demonstrated a decrease in phytotoxicity and earthworm mortality, alongside a significant increase in the relative abundance of actinobacteria, which are associated with the humification process. This research establishes and proposes that co-composting with quinones-containing waste is an effective approach for the sustainable recycling of hazardous solid waste.
RESUMO
Despite much progress, image processing remains a significant bottleneck for high-throughput analysis of microscopy data. One popular platform for single-cell time-lapse imaging is the mother machine, which enables long-term tracking of microbial cells under precisely controlled growth conditions. While several mother machine image analysis pipelines have been developed in the past several years, adoption by a non-expert audience remains a challenge. To fill this gap, we implemented our own software, MM3, as a plugin for the multidimensional image viewer napari. napari-MM3 is a complete and modular image analysis pipeline for mother machine data, which takes advantage of the high-level interactivity of napari. Here, we give an overview of napari-MM3 and test it against several well-designed and widely used image analysis pipelines, including BACMMAN and DeLTA. Researchers often analyze mother machine data with custom scripts using varied image analysis methods, but a quantitative comparison of the output of different pipelines has been lacking. To this end, we show that key single-cell physiological parameter correlations and distributions are robust to the choice of analysis method. However, we also find that small changes in thresholding parameters can systematically alter parameters extracted from single-cell imaging experiments. Moreover, we explicitly show that in deep learning-based segmentation, 'what you put is what you get' (WYPIWYG) - that is, pixel-level variation in training data for cell segmentation can propagate to the model output and bias spatial and temporal measurements. Finally, while the primary purpose of this work is to introduce the image analysis software that we have developed over the last decade in our lab, we also provide information for those who want to implement mother machine-based high-throughput imaging and analysis methods in their research.
Assuntos
Processamento de Imagem Assistida por Computador , Mães , Feminino , Humanos , Microscopia , Cultura , PesquisadoresRESUMO
Black rot, caused by Xanthomonas campestris pv. campestris (Xcc) significantly affects the production of cabbage and other cruciferous vegetables. Plant antioxidant system plays an important role in pathogen invasion and is one of the main mechanisms underlying resistance to biological stress. Therefore, it is important to study the resistance mechanisms of the cabbage antioxidant system during the early stages of Xcc. In this study, 108 CFU/mL (OD600 = 0.1) Xcc race1 was inoculated on "zhonggan 11" cabbage using the spraying method. The effects of Xcc infection on the antioxidant system before and after Xcc inoculation (0, 1, 3, and 5 d) were studied by physiological indexes determination, transcriptome and metabolome analyses. We concluded that early Xcc infection can destroy the balance of the active oxygen metabolism system, increase the generation of free radicals, and decrease the scavenging ability, leading to membrane lipid peroxidation, resulting in the destruction of the biofilm system and metabolic disorders. In response to Xcc infection, cabbage clears a series of reactive oxygen species (ROS) produced during Xcc infection via various antioxidant pathways. The activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) increased after Xcc infection, and the ROS scavenging rate increased. The biosynthesis of non-obligate antioxidants, such as ascorbic acid (AsA) and glutathione (GSH), is also enhanced after Xcc infection. Moreover, the alkaloid and vitamin contents increased significantly after Xcc infection. We concluded that cabbage could resist Xcc invasion by maintaining the stability of the cell membrane system and improving the biosynthesis of antioxidant substances and enzymes after infection by Xcc. Our results provide theoretical basis and data support for subsequent research on the cruciferous vegetables resistance mechanism and breeding to Xcc.
Assuntos
Antioxidantes , Brassica , Doenças das Plantas , Xanthomonas campestris , Xanthomonas campestris/fisiologia , Xanthomonas campestris/patogenicidade , Brassica/microbiologia , Brassica/metabolismo , Antioxidantes/metabolismo , Doenças das Plantas/microbiologia , Espécies Reativas de Oxigênio/metabolismoRESUMO
Evidence suggests associations between COVID-19 patients or vaccines and glycometabolic dysfunction and an even higher risk of the occurrence of diabetes. Herein, we retrospectively analyzed pancreatic lesions in autopsy tissues from 67 SARS-CoV-2 infected non-human primates (NHPs) models and 121 vaccinated and infected NHPs from 2020 to 2023 and COVID-19 patients. Multi-label immunofluorescence revealed direct infection of both exocrine and endocrine pancreatic cells by the virus in NHPs and humans. Minor and limited phenotypic and histopathological changes were observed in adult models. Systemic proteomics and metabolomics results indicated metabolic disorders, mainly enriched in insulin resistance pathways, in infected adult NHPs, along with elevated fasting C-peptide and C-peptide/glucose ratio levels. Furthermore, in elder COVID-19 NHPs, SARS-CoV-2 infection causes loss of beta (ß) cells and lower expressed-insulin in situ characterized by islet amyloidosis and necrosis, activation of α-SMA and aggravated fibrosis consisting of lower collagen in serum, an increase of pancreatic inflammation and stress markers, ICAM-1 and G3BP1, along with more severe glycometabolic dysfunction. In contrast, vaccination maintained glucose homeostasis by activating insulin receptor α and insulin receptor ß. Overall, the cumulative risk of diabetes post-COVID-19 is closely tied to age, suggesting more attention should be paid to blood sugar management in elderly COVID-19 patients.
Assuntos
COVID-19 , Diabetes Mellitus , Adulto , Animais , Humanos , Idoso , SARS-CoV-2 , Receptor de Insulina , Peptídeo C , DNA Helicases , Estudos Retrospectivos , Proteínas de Ligação a Poli-ADP-Ribose , RNA Helicases , Proteínas com Motivo de Reconhecimento de RNA , GlucoseRESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
Background: Transcranial Direct Current Stimulation (tDCS) is a non-invasive brain stimulation technique. Constant electric current is passed through the patient's scalp with the aim of modulating cortical excitability. Stroke is a cerebrovascular disease characterized by hemorrhage or cerebral ischemia. This systematic review and meta-analysis are aimed at comparing the efficacy of motor cortex stimulation with that of cerebellar stimulation by using transcranial direct current stimulation. Method: Google Scholar, PubMed, EMBASE, Cochrane CENTRAL, and Physiotherapy Evidence Database (Pedro) databases were searched for studies. The extracted qualitative data was synthesized systematically. Cochrane RevMan software was used to conduct a meta-analysis of quantitative data. The fixed effects mean difference of the collected data was calculated at a 95% confidence interval (CI) for the changes in balance and side effects. Results: This research included 10 articles with seven studies assessing changes in balance (outcome measured in CoP and FMA scores) and side effects (tingling and itching were the most prevalent). There was no significant difference between the efficacy levels of m1-tDCS versus ctDCS (P = 0.18), m1-tDCS versus sham (P = 0.92), and ctDCS versus sham (P = 0.19). Itching and tingling sensation were the most common and were significantly prevalent in sham interventions (P < 0.00001). Conclusion: We found that motor cortex and cerebellar stimulations are both effective in improving motor function in stroke patients. There are no adverse effects to using the interventions besides mild itching and tingling experienced during the stimulation.
RESUMO
To minimize errors in calculating coal flue gas adsorption capacity due to gas compressibility and to preclude prediction inaccuracies in abandoned mine flue gas storage capacity for power plants, it is imperative to account for the influence of compression factor calculation accuracy while selecting the optimal theoretical adsorption model. In this paper, the flue gas adsorption experiment of a power plant with coal samples gradually pressurized to close to 5 MPa at two different temperatures is carried out, and the temperature and pressure data obtained from the experiment are substituted into five different compression factor calculation methods to calculate different absolute adsorption amounts. The calculated adsorption capacities were fitted into six theoretical adsorption models to establish a predictive model suitable for estimating the coal adsorption capacity in power plant flue gas. Results reveal significant disparities in the absolute adsorption capacity determined by different compression factors, with an error range of 0.001278-7.8262 (cm3/kg). The Redlich-Kwong equation of state emerged as the most suitable for the flue gas of the selected experimental coal sample and the chosen composition ratio among the five compression factors. Among the six theoretical adsorption models, the Brunauer-Emmett-Teller model with three parameters demonstrated the highest suitability for predicting the adsorption capacity of coal samples in power plant smoke, achieving a fitting accuracy as high as 0.9922 at 49.7 °C.
RESUMO
Asthma is a serious global health problem affecting 300 million persons around the world. Mast cells (MCs) play a major role in airway hyperresponsiveness (AHR) and inflammation in asthma, their exact effector mechanisms remain unclear. Here, we aim to investigate the inhibitory effect of Bergapten (BER) on MRGPRX2-mediated MCs activation through asthma model. Mouse model of asthma was established to examine the anti-asthmatic effects of BER. Calcium (Ca2+) influx, ß-hexosaminidase and histamine release were used to assess MCs degranulation in vitro. RNA-Seq technique was conducted to study the gene expression profile. RT-PCR and Western Blotting were performed to examine targeting molecules expression. BER inhibited AHR, inflammation, mucous secretion, collagen deposition and lung MCs activation in asthma model. BER dramatically reduced levels of IL4, IL-5, and IL-13 in bronchoalveolar lavage fluid (BALF), as well as inflammatory cells. BER also reduced serum IgE levels. Pretreatment MCs with BER inhibited substance P (SP)-induced Ca2+ influx, degranulation and cytokines release from MCs. BER also reduced the phosphorylation levels of PKC, PLC, IP3R, AKT and ERK, which were induced by SP. Furthermore, RNA-seq analysis showed that SP up-regulated 68 genes in MCs, while were reversed by BER. Among these 68 genes, SP up-regulated NR4A1 expression, and this effect was inhibited by BER. Meanwhile, knockdown of NR4A1 significantly attenuated SP-induced MCs degranulation. In conclusion, NR4A1 plays a major role in MRGPRX2-mediated MCs activation, BER inhibited AHR and inflammation in asthmatic model by inhibiting MCs activation through MRGPRX2-NR4A1 pathway.
Assuntos
5-Metoxipsoraleno , Anti-Inflamatórios , Asma , Mastócitos , Animais , Camundongos , 5-Metoxipsoraleno/farmacologia , 5-Metoxipsoraleno/uso terapêutico , Asma/tratamento farmacológico , Degranulação Celular , Inflamação/tratamento farmacológico , Pulmão/metabolismo , Mastócitos/efeitos dos fármacos , Receptores Acoplados a Proteínas G/metabolismo , Substância P/metabolismo , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Camundongos Endogâmicos C57BL , FemininoRESUMO
The distinctive three-dimensional architecture, biological functionality, minimal immunogenicity, and inherent biodegradability of small intestinal submucosa extracellular matrix materials have attracted considerable interest and found wide-ranging applications in the domain of tissue regeneration engineering. This article presents a comprehensive examination of the structure and role of small intestinal submucosa, delving into diverse preparation techniques and classifications. Additionally, it proposes approaches for evaluating and modifying SIS scaffolds. Moreover, the advancements of SIS in the regeneration of skin, bone, heart valves, blood vessels, bladder, uterus, and urethra are thoroughly explored, accompanied by their respective future prospects. Consequently, this review enhances our understanding of the applications of SIS in tissue and organ repair and keeps researchers up-to-date with the latest research advancements in this area.
RESUMO
BACKGROUND: Recombinant human TPO (rhTPO) promotes platelet engraftment in patients after allogeneic HSCT (allo-HSCT). However, the effects of rhTPO on platelet recovery after Haplo-HSCT in patients with severe aplastic anemia (SAA) have not been intensively studied. OBJECTIVE: We aimed to evaluate the efficacy of rhTPO on platelet engraftment in patients with SAA who were treated with Haplo-HSCT using post-transplantation cyclophosphamide (PTCy). STUDY DESIGN: SAA patients who received Haplo-HSCT plus PTCy regimen were divided into the rhTPO group (with subcutaneous injection of rhTPO, n = 28) and Control group (no rhTPO administration, n = 27). The engraftment of platelet/neutrophil, platelet infusion amount, and transplant-related complications between the 2 groups were compared. RESULTS: All 55 patients showed successful hematopoietic reconstitution. The median time of platelet engraftment was 11 (9 to 29) days in the rhTPO group and 14 (9 to 28) days in the Control group (P = .003). The rhTPO group had a significantly reduced amount of infused platelets compared to the Control group (2 (1 to 11.5) versus 3 (1 to 14) therapeutic doses; P = .004). There was no significant difference between the 2 groups regarding median time of neutrophil engraftment, incidence of acute graft-versus-host disease (aGVHD) and chronic GVHD (cGVHD), incidence of cytomegalovirus or Epstein-Barr virus reactivation, 3-yr overall survival rate, and failure-free-survival rate. No obvious adverse reactions were observed in the rhTPO group. CONCLUSION: rhTPO promoted platelet engraftment, reduced the amount of transfused platelets, and demonstrated good safety profiles without evidence of adverse reactions in patients with SAA who received Haplo-HSCT using PTCy regimen.
RESUMO
Fast adversarial training (FAT) is an efficient method to improve robustness in white-box attack scenarios. However, the original FAT suffers from catastrophic overfitting, which dramatically and suddenly reduces robustness after a few training epochs. Although various FAT variants have been proposed to prevent overfitting, they require high training time. In this paper, we investigate the relationship between adversarial example quality and catastrophic overfitting by comparing the training processes of standard adversarial training and FAT. We find that catastrophic overfitting occurs when the attack success rate of adversarial examples becomes worse. Based on this observation, we propose a positive prior-guided adversarial initialization to prevent overfitting by improving adversarial example quality without extra training time. This initialization is generated by using high-quality adversarial perturbations from the historical training process. We provide theoretical analysis for the proposed initialization and propose a prior-guided regularization method that boosts the smoothness of the loss function. Additionally, we design a prior-guided ensemble FAT method that averages the different model weights of historical models using different decay rates. Our proposed method, called FGSM-PGK, assembles the prior-guided knowledge, i.e., the prior-guided initialization and model weights, acquired during the historical training process. The proposed method can effectively improve the model's adversarial robustness in white-box attack scenarios. Evaluations of four datasets demonstrate the superiority of the proposed method.